T-complex protein 1 subunit zeta-2 (CCT6B) deficiency induces murine teratospermia

Animals

Animal care and treatment protocols were designed based upon the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Nanjing Medical University, and all protocols described herein have received approval from the Animal Ethical and Welfare Committee (Approval No. IACUC-2009002-1).

All mice were obtained from and maintained under SPF conditions in the Laboratory Animal Center of Nanjing Medical University. Mice were housed in a climate-controlled facility (20–22 °C, 50–70% humidity, 12 h light/dark cycle) with free food and water access. All mice were treated humanely and all efforts were made to minimize suffering. When appropriate, mice were euthanized via cervical dislocation prior to tissue sample collection. There were no surviving animals at the end of study.

Antibodies

Rabbit anti-CCT6B (NBP2-92177) was purchased from Novus. Rabbit anti-β-TUBULIN was purchased from ABways (AB0039). LIN28A (ab46020) and anti-γH2AX (ab26350) were purchased from Abcam. Mouse anti-AC-Tubulin (T6793) was purchased from Sigma. Rabbit anti-SOX9 (AB5535) was purchased from Merck.

CRISPR/Cas9-mediated Cct6b^−/− mouse generation

Cct6b-knockout mice were generated via a CRISPR/Cas9 approach as detailed previously (Wang et al., 2020; Zhang et al., 2019; Zhu et al., 2020). Briefly, single-guide RNAs (sgRNAs) targeting CCT6B exon 4 were designed with the following sequences: 5′-GACGAAAGTTCATGCTGAACTGG-3′ and 5′-ATGTTCTAGCCACATCCAAGAGG-3′. The Cas9 and sgRNA plasmids were respectively linearized using AgeI and DraI respectively, and were then purified with a MinElute PCR Purification Kit (Qiagen, Duesseldorf, Germany). A MESSAGE mMACHINE T7 Ultra Kit (Ambion, TX, USA) was used to generate the Cas9 mRNA, while a MEGA Shortscript and Clear Kit (Ambion) was used to prepare the purified sgRNA. Wild-type C57BL/6 superovulated females were then mated with C57BL/6 males to generate zygotes for Cas9 mRNA and sgRNA injection.

T7EI cleavage assay and sequencing

Genomic DNA (gDNA) was extracted from testes using the Universal Genomic DNA kit (CW2298M; CWBIO) and amplified using Phanta Max super-fidelity DNA polymerase (p525; VAZYME) and the primers listed in Table S2. After agarose gel electrophoresis, PCR products were purified using a PCR cleanup kit (AP-PCR-250; Axygen). A T7EI cleavage assay was then used for genotyping as described previously (Shen et al., 2013). Briefly, after having been mixed with Buffer 2 (NEB), purified PCR products were denatured and re-annealed using a thermocycler. Then, the PCR products were digested using T7EI (M0302L; NEB) for 25 min at 37 °C and separated on a 2.3% agarose gel.

Off-target effect assay

Using the open tool CRISPOR (http://crispor.tefor.net/) (Concordet & Haeussler, 2018), we predicted potential off-target sites based on the sequence of the target site. Off-target site selection was performed as described previously (Niu et al., 2014). Briefly, the aNy base–Guanosine–Guanosine (NGG) sequence was chosen as the protospacer adjacent motif (PAM), and sites with eight conserved base pairs proximal to the PAM with three or fewer total mismatches were chosen as potential off-target sites. Potential off-target loci were first amplified from gDNA extracted from the testes of founder mice with the primers listed in Table S2. PCR fragments including the off-target loci were then subjected to the T7EI cleavage assay. Sanger sequencing of PCR products with typical T7EI cleavage bands was then performed.

Genotyping

Edited founders harboring Cct6b frameshift mutations were mated with wild type mice for a minimum of three generations to eliminate the potential effects of off-target gene editing. PCR amplification was used to confirm the genotypes of the resultant offspring (primers: forward, 5′- GCATACTTACTACTCGGAGAGCAT -3′; reverse, 5′-CAGAGATAAGAAGGTGGCATTGGA -3′), and Sanger sequencing was additionally conducted, with the results being analyzed via SnapGene (v.3.2.1).

qPCR

An RNeasy Plus Micro Kit with on-column DNase digestion (Qiagen Ltd., 74034) was used to extract RNA from murine tissues. A heat-sterilized Teflon micropestle containing 350 µl of RLT buffer and 4 µl of β-mercaptoethanol was used to homogenize samples, after which RNA was isolated based on provided directions, with samples being maintained on ice at all times. Final RNA samples were eluted in 14 µl of RNase-free water, after which 1 µg of total RNA per sample was used to prepare cDNA with a PrimeScript RT reagent Kit (TaKaRa Bio Inc., RR037A). Both oligo(dT) and random primers were used for the reverse transcription. After a 15 min incubation at 37 °C, reverse transcriptase was heat-inactivated for 5 s at 85 °C. The samples were maintained on ice throughout the RNA extraction and reverse transcription. A qPCR instrument (StepOne-Plus, Applied Biosciences) was then used to conduct triplicate gene expression analyses via a SYBR green approach. All qPCR primers are compiled in Table S1, and 18S rRNA served as a normalization control.

Western blotting

Western blotting was conducted using a slightly modified version of a previously published protocol (Zheng et al., 2015). Briefly, a lysis buffer (7M urea, 2M thiourea, 2% (w/v) DTT) containing a 1% (v/w) protease inhibitor mixture (Pierce Biotechnology) was used to extract proteins, which were subsequently separated via SDS-PAGE and transferred to PVDF membranes. These blots were then blocked for 2 h at room temperature with 5% nonfat milk in TBST, followed by overnight (>12 h) incubation with primary antibodies at 4 °C. Anti-CCT6B was used at a 1:1000 dilution, while anti-β-TUBULIN was used at a 1:3000 dilution. After three washes with TBST, blots were then probed for 2 h with secondary antibodies, after which the SuperSignalWest Femto Chemiluminescent Substrate Western Blotting detection system (Thermo Scientific) was used to detect protein bands.

Histological analyses

Murine testes or epididymal tissues were collected from a minimum of three mice per genotype and were fixed for 24 h in modified Davidson’s fluid prior to storage in 70% ethanol. A graded ethanol series was then used to dehydrate these samples, which were paraffin-embedded and cut to prepare 5 μm-thick sections that were mounted onto glass slides. Following deparaffinization, these sections were subjected to Periodic Acid Schiff or Hematoxylin and eosin (H&E) staining to facilitate histological analyses.

Sperm analysis

Sperm analyses were conducted as in prior reports (Castaneda et al., 2017; Jiang et al., 2014). Briefly, distal and clamping of the cauda region of the right epididymis was conducted for each mouse, after which this section was excised, washed with warm PBS, and added to an Eppendorf tube containing fresh human tubal fluid (HTF) media (Millipore) containing 10% FBS at 37 °C. Clamping was then reversed, and the cauda was pierced with the tip of a scalpel to enable the sperm to diffuse into the medium for 5 m in at 37 °C. Sperm were then diluted using additional medium to enable a sperm motility analysis of a 10 µl sperm suspension via computer-assisted semen analysis detection (Hamilton Thorne Research Inc.).

Immunofluorescence staining

Following deparaffinization, tissue sections were rehydrated, washed thrice with PBS (10 min/wash), and boiled in 10 mM citrate buffer (pH 6.0) in a microwave to facilitate antigen retrieval. A microwave oven for 10 min. For spermatozoa samples, preparation was instead conducted by spreading cells onto microscope slides and allowed to air-dry. These cells were then fixed for 10 min using 1% paraformaldehyde in PBS.

Immunofluorescent staining was conducted by washing samples thrice with PBST (10 min/wash), followed by a 1 h blocking step using 1% BSA. Samples were then incubated overnight (>12 h) with appropriate primary antibodies at 4 °C, followed by incubation for 2 h with secondary antibodies. Anti-LIN28A was used at 1:500, anti-SOX9 at 1:500, anti-γH2AX was used at 1:100, and anti-AC-TUBULIN was used at 1:500. Hoechst 33342 was used to counterstain nuclei for 5 min, after which slides were rinsed with PBS and mounted using VectaShield or Immu-Mount. An LSM800 confocal microscope (Carl Zeiss AG) was then used to image the stained slides.

Transmission electron microscopy

Ultrastructural analyses were performed as in prior reports (Hua et al., 2019). Briefly, testes from adult mice were isolated and fixed overnight using 2.5% (v/v) glutaraldehyde in 0.2 M cacodylate buffer (50 mM cacodylate, 50 mM KCl, and 2.5 mM MgCl2, pH 7.2). After subsequent washing in this buffer, the tissues were cut into ∼1 mm³ pieces and submerged in 1% OsO4 in 0.2 M cacodylate buffer for 2 h at 4 °C. Samples were then washed again prior to overnight immersion in 0.5% uranyl acetate. After dehydration with an ethanol gradient, these samples were embedded in resin using the Low Viscosity Embedding Media Spurr’s Kit (EMS, 14300). An ultramicrotome was then used to prepare ultrathin sample sections that were mounted onto copper grids, stained for 10 min with lead citrate and uranyl acetate, and assessed with a JEM-1400 transmission electron microscope (JEOL).

Statistical analysis

Data are means ± SEM, and were compared via two-tailed Student’s t-tests. Not significant (NS): P ≥ 0.05; ^∗P < 0.05; ^∗∗P < 0.01; ^∗∗∗P < 0.001; ^∗∗∗∗P < 0.0001.

Assessment of murine CCT6B expression patterns

Given that Cct6b is evolutionarily conserved (Fig. S1), it is likely to play conserved functions in animals expressing this gene. To explore these functions, we assessed Cct6b expression patterns in mice via qPCR, revealing abundant expression of this gene in the testis but not in other analyzed tissues (Fig. 1A). The first round of spermatogenesis in murine testis is relatively synchronous. As such, we collected testis tissue Cct6b expression in mice at different numbers of weeks after birth (W) in order to capture the initial spermatogenesis wave. This analysis revealed Cct6b expression beginning at week 3, which is the developmental stage during which spermatids emerge in murine testes (Fig. 1B).

Cct6b^−/− mouse generation

To explore the functional importance of Cct6b in spermatogenesis, we next used a CRISPR/Cas9 approach to generate C57BL/6 mice in which this gene had been knocked out. To accomplish this, a frameshift mutation in exon 4 of the Cct6b gene was introduced into super-ovulated fertilized mouse eggs (Fig. 2A). The mutation causes p.Glu125Gly fs ter22 (Fig. S2), and has the potential to result in the nonsense-mediated decay of the encoded mRNA. Relative to wild-type controls, animals in the F2 Cct6b^−/− generation harbored a 5bp deletion in exon 4 of Cct6b as detected by PCR and Sanger sequencing (Fig. 2B). Western blotting and qPCR further confirmed that the expression of Cct6b was completely absent at the protein level and markedly reduced at the mRNA level in the testes of Cct6b^−/− mice (Figs. 2C–2D). Concerns involving off-target mutations associated with the CRISPR/Cas9 system have been previously expressed (Pattanayak et al., 2013; Sander & Joung, 2014), and as such, we analyzed these animals for any potential off-target events. We first excluded the potential off-target effects of the sgRNAs on other CCT genes. Although there is a high degree of homology among the CCT family proteins, there were still multiple mismatched base pairs at the sgRNA site (Figure. S3A). More importantly, protospacer adjacent motif (PAM) sequences at the sgRNA sites of other CCT family members are not conserved, and these play a crucial role in the efficiency of sgRNA cleavage (Fig. S3A) (Cong et al., 2013; Mojica et al., 2009). In addition, predicted off-target sites within the genome were identified, and a subsequent T7E1 assay exhibited no off-target effects on these sites (Table S3 and Fig. S3B). The Cct6b^−/− mice were viable and developmentally normal. Collectively, these results indicated that we had successfully constructed a Cct6b-knockout mouse line.

Cct6b^−/− mice exhibit normal spermatogenesis

The fertility of male mice was next assessed by housing Cct6b^+∕+ or Cct6b^−∕− males with wild-type females for 4 months and recording the number of offspring per litter. The average number of pups per litter for Cct6b^+∕+ mating pairs was 4.5 ±  1.22, while Cct6b^−/− males sired an average of 5 ± 1.87 pups per litter. This suggests that Cct6b is dispensable for male fertility (Fig. 3A). No differences in testes (n = 3) or epididymis (Figs. 3B–3C) size were observed when comparing mice in these two groups, and PAS staining did not reveal any differences in spermatogenesis when assessing testes or epididymal tissues from these mice. The average numbers of spermatocytes, round spermatids, and elongated spermatids per tubule were comparable when comparing adult wild-type and Cct6b^−/− testes (Figs. 3D–3E). In addition, immunofluorescent staining revealed normal spermatogonia self-renewal, meiotic progression, and acrosome formation in these two groups (Figs. 4A–4C), and comparable SOX9 expression was evident in Cct6b^+∕+ and Cct6b^−/− mice (Figs. 4D–4E). Together, these results indicated that Cct6b^−/− mice are fertile and exhibit normal spermatogenesis.

CCT6B knockout results in the bending of the sperm neck

After developing in the testes, spermatozoa enter the epididymis. However, no differences were observed when assessing H&E-stained epididymal samples from these two groups of mice (Fig. 5A). We therefore directly assessed sperm quality in Cct6b^−∕− males with a Computer-Assisted Sperm Analyzer (CASA). The overall epididymal cauda sperm counts were comparable for Cct6b^+∕+ and Cct6b^−∕− animals (Fig. 5B), and sperm motility was also similar in these two groups (Fig. 5C). However, sperm from Cct6b^−/− mice exhibited significantly decreased progressive motility (Fig. 5D). Morphological analyses also revealed that the ratio of normal sperm (n = 3, P = 0.006) was significantly decreased in male Cct6b^−/− mice, with nuclear base bending being the primary abnormality evident in these mice (n = 3, P = 0.005) (Figs. 5E–5F). However, immunofluorescent staining suggested that the major structures of these malformed sperm, including the flagella and acrosome, remained normal (Fig. 5G). To assess whether the occurrence of bent neck Cct6b^−/− sperm was the result of defective flagellar organization, we employed TEM to directly evaluate sperm morphology. No significant differences were observed when comparing flagella between Cct6b^−/− and Cct6b^+∕+ sperm, but cytoplasmic retention around the head of Cct6b^−/− sperm was observed via this approach, as was the curling of the flagellar tail in the cytoplasm (Fig. 6). Together, these results indicated that Cct6b knockout can result in teratospermia characterized by neck bending and cytoplasmic redundancy.

Other CCT complex components exhibit decreased transcript abundance in Cct6b^−/− mice

Given the function of CCT6B as a CCT complex protein, and the high degree of homology between CCT6B and the other CCT proteins, we additionally explored the impact of knocking out this gene on other CCT complex components at the mRNA level. Compared with the control group, the mRNA expression levels of other CCT family genes were not significantly increased in Cct6^−/− testes, (Fig. 7), suggesting that the loss of function of CCT6B was not compensated for by the upregulation of other CCT complex components.