Central Angiotensin II type 1 receptor deficiency alleviates renal fibrosis by reducing sympathetic nerve discharge in nephrotoxic folic acid–induced chronic kidney disease

Experimental animals

For the animal experiments, male mice aged 8–10 weeks and weighing 20–24 g were employed. Wildtype controls consisted of age- and sex-matched C57BL/6J mice obtained from the same vendor. The mice were maintained in specific pathogen-free (SPF) conditions with unrestricted access to food and water. They were then randomly allocated into four groups: sham, folic acid nephropathy at 7 days, 14 days, and 28 days groups. Male C57BL/6J mice were administered a single intraperitoneal injection of folic acid (Sigma-Aldrich, St. Louis, MO, USA) at a dosage of 250 mg/kg, dissolved in a 0.3 mol/L sodium bicarbonate solution. They were euthanized after 7, 14, or 28 days (Martin-Sanchez et al., 2017). Control mice was administered a single intraperitoneal injection of sodium bicarbonate. Each group consisted of six mice housed in animal cages, totaling approximately 72 mice used in the study. The sample sizes were determined based on our previous experiments. Euthanasia was performed by cervical dislocation following intraperitoneal injection of an overdose of 1.5% pentobarbital sodium anesthetic (100 mg/ml). Humane endpoints were established, and animals were euthanized before the planned end of the experiment if they exhibited one of the following conditions: rapid weight loss of 15–20%, persistent hypothermia, or clear signs of imminent death. Mice that were euthanized prematurely or exhibited large individual differences were excluded from the statistical analysis. All experimental procedures were approved by animal Ethics Committee of Nanfang Hospital (NFYY-2019-0135) and the Animal Ethics Committee of Shenzhen Zhongke Industrial Holdings Co. (20240015), and were conducted in compliance with their guidelines.

The Agtr1a-floxed mice (AT1a^fl/fl, CKOCMP-21237-Agtr1a) with C57BL/6J genetic background were procured from Cyagen Bioscience (Guangzhou, China).

To block sympathetic traffic, groups of mice with FA-CKD underwent total kidney denervation (Cao et al., 2017). To delete AT1_a in the PVN, AAV-hsyn-Cre (Hanbio Biotechnology, Cat# HBAAV-3017) was injected into the PVN of AT1a^fl/fl mice.

Brain surgery and viral injections

Mice were anesthetized with intraperitoneal injection of sodium pentobarbital and then positioned within a stereotactic apparatus (Stoelting, IL, USA). Following the creation of a small craniotomy hole, virus injections were administered using a micropipette connected to a Nanoliter Injector (NANOLITER 2020; WPI, Sarasota, FL, USA) and its controller (Micro4, WPI). To selectively delete AT1_a in the PVN, bilateral injections of AAV-hSyn-Cre (virus titers:5.24 10¹² vector genomes /ml; 0.3 uL/injection) were performed in the PVN of AT1a^fl/fl mice. For retrograde labeling with dyes, a glass needle loaded with PBS containing 1.0 mg/mL of CTb-555 was placed at the RVLM (Nomura et al., 2019). All AAVs (Serotype 2/9) and rAAVs (Serotype 2/retro) were sourced from Brain VTA Co., Ltd. Injection coordinates were referenced to bregma, as per the Paxios and Franklin Mouse Brain Atlas. The coordinates for PVN were: anteroposterior, −0.8 mm; lateral, G0.2 mm; ventral, −5.0 mm. The coordinates for RVLM were: anteroposterior, −6.8 mm; lateral, +1.1 mm; ventral, −5.9 mm. Immunostaining was conducted to confirm all injection sites (Su et al., 2023).

Recording sympathetic nerve activity

For assessing kidney sympathetic nerve activity, mice were anesthetized with urethane. The kidney nerve fibers were isolated. The nerves near the incision were then placed onto a pair of platinum electrodes (Unique Medical) to record sympathetic nerve activity. The nerve signal was amplified 10,000 times using an ERS 100C amplifier and filtered with a band-pass between 1 and 3,000 Hz. Subsequently, the nerve signal was collected and processed simultaneously by a recording system (Acqknowledge, Biopac System, CA, USA), and then stored for offline analysis. At the conclusion of each experiment, euthanasia was performed; any residual electrical activity was considered background noise and subtracted from the total activity recorded during the experiment to obtain an estimate of the true neural activity. Nerve action potentials were quantified using a spike discriminator (Acqknowledge, Biopac System, CA, USA), with the threshold level set slightly above the noise level and kept constant throughout the experiment (Su et al., 2023).

Measurement of kidney norepinephrine (NE) and Ang II

Kidney tissue NE concentrations were quantified using an ELISA kit (Demeditec Diagnostics, Kiel, Germany).

After the mice were euthanized, blood was collected, and physiological saline was perfused. The whole brain was placed in dry ice to cool. On the day of ANGII detection, the paraventricular nucleus was dissected from flash-frozen brains in the chamber of a cryostat (at −15 °C). The brains were placed in a cooled metal brain block, and remove the PVN tissue using the blade and the anatomical location of the PVN. Specifically, the cross-sectional area of the PVN is typically between 0.2 and 0.5 square millimeters, while the volume generally falls between 0.5 and 1 cubic millimeter. The tissue Ang II levels were determined via liquid chromatography/mass spectrometry (Ali et al., 2014).

Kidney histological procedures

Mice were anesthetized, and their kidneys were excised, embedded in paraffin, and sliced at a thickness of 3 um. Kidney fibrosis was assessed by stained with Masson’s trichrome and fibrosis was quantified using the NIH ImageJ program (Cui et al., 2018).

In situ hybridization

Mice brains were harvested and perfused with 4% paraformaldehyde, followed by preparation of 50 µm frozen sections. Subsequently, brain sections underwent digestion with proteinase K and hybridization with a digoxigenin-labeled LNATM Detection Probe for AT1a (Qiagen, Hilden, Germany) at 54 °C for over 16 h. The sections were incubated with peroxidase-conjugated sheep anti-digoxigenin (1:5000, 11-207-733-910, Roche, Basel, Switzerland) at 4 °C for 16 h, and then subjected to detection using the TSA-Plus Fluorescence System (APExBIO, TX, USA). The probe sequence for AT1a was /5DiGN/ATGTCACGGTTGGTACAAGCA/3DiG _N/.

Immunostaining

Immunostaining procedures followed previously published methods (Cao et al., 2017). Briefly, paraffin sections (3 um thick) and frozen brain sections (50 um thick) were incubated with primary antibodies at 4 °C for 24 h, followed by incubation with corresponding secondary antibodies at 4 °C for another 24 h. Afterward, the sections were mounted onto glass slides and observed using a Leica confocal microscope (Leica TCS SP2 AOBS; Leica, Buffalo Grove, IL, USA). The primary antibodies used included: anti-Cre (1:1000, ab190177), anti-Ang II (1:800, T-4007, Peninsula Laboratories, CA, USA), anti-AGT (1:100, A6279; ABclonal, Wuhan, China), anti-c-fos (1:50, ab208942) (all sourced from Abcam, Cambridge, UK), and anti-tyrosine hydroxylase (1:100, PB9449) (all obtained from Boster, Wuhan, China).

Quantitative PCR (qPCR)

Total RNA was isolated from 50 mg of each tissue sample stored at −80 °C, following the protocol provided with the RNAex Pro RNA Extraction Reagent (#AG21102; Accurate Biotechnology, Shenzhen, China). RNA quality was verified using a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), ensuring an A260/280 ratio between 1.8 and 2.0. Genomic DNA was digested, and reverse transcription was conducted using the Evo M-MLV RT Mix Kit and the gDNA Clean for qPCR kit (#AG77128; Accurate Biotechnology, Shenzhen, China). Subsequently, 1.0 µg of RNA was converted into cDNA using oligo(dT) primers in a 20 µL reaction mixture. The reverse transcription was carried out at 37 °C for 15 min, followed by 5 s at 85 °C. The cDNA was then stored at −80 °C. qPCR was performed using a LightCycler 96 Real-Time PCR Detection System with a 20 µL reaction mixture containing 2 µL of cDNA, 10 µL of 2X SYBR Green Pro Taq HS Premix (#AG11701; Accurate Biotechnology, Shenzhen, China), and gene-specific primers (AXYGEN, PCR-0208-C). The PCR protocol included an initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Melting curve analysis was conducted at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 5 s, resulting in a unimodal dissolution curve. No Cq value was observed for the No Template Control (NTC). Gene-specific primers (Table S1) were designed to produce amplicons of approximately 100 bp, confirmed via NCBI BLAST. Fold changes in RNA levels were calculated using the 2⁽- Δ ΔCT) method, with GAPDH as the internal reference. The slope ranged between −3.59 and −3.1, with an R² value of ≥0.9. The limit of detection (LOD) was determined to be 2.5 target molecules with a 95% confidence interval. Data analysis excluded any technical replicates that significantly deviated from the other two values among the three technical replicates. Each sample was analyzed in three technical replicates to ensure reliable results.

Quantitative and statistical analysis

Continuous variables were presented as mean ± SD. Group differences were assessed using one-way ANOVA or unpaired t-tests with Bonferroni correction for multiple comparisons (SPSS software, version 19.0; SPSS, Inc., Chicago, IL, USA). A p-value of less than 0.05 was considered statistically significant.

The SNS activity and Ang II expression in the PVN is increased in nephrotoxic folic acid-induced CKD mice

To investigate the underlying mechanisms of toxicity-induced chronic kidney disease, a model of CKD induced by folic acid was utilized. Figure 1 depicts a progressive increase in renal fibrosis (Figs. 1A and 1B), as evaluated through histological analysis from day 7 to day 28 post-induction. Concurrently, there was a progressive rise in both SNS activity within the kidney (Fig. 1C) and levels of NE in the kidney (Fig. 1D) over the same timeframe.

The local renin-angiotensin system was evaluated in the PV of the hypothalamus from mice with FA-CKD or sham-operated mice, from day 7 to day 28. Between days 7 and 28 post-folic acid-induced kidney injury, there was a notable increase in the abundance of cells expressing Ang II and angiotensinogen (AGT) within the PVN (Figs. 2A and 2C). This elevation correlated with an upregulation of Ang II protein levels and AGT mRNA levels in the PVN (Figs. 2B and 2D). However, there were no observed changes in the expression of angiotensin II receptor type 1a (AT1a) in the PVN region (Fig. S1A), nor in the levels of Ang II in the plasma following folic acid-induced kidney injury (Fig. S1B). Thus, The progressive fibrosis observed in folic acid-induced kidney injury was linked to continuous upregulation of Ang II in the PVN, as well as sustained elevation in SNS activity directed towards the kidney. .

Stimulation of AT1aR signaling in the PVN amplifies kidney SNS output, thus facilitating fibrosis in FA-CKD mice

To investigate the causal relationship between AT1aR signaling in the PVN and kidney fibrosis in FA-CKD mice, selective deletion of AT1a was performed in the PVN. This was achieved by injecting an adeno-associated virus that encodes Cre-recombinase, which was controlled by a neuron-specific promoter (synaptophysin), into the PVN of AT1a^fl/fl mice (AAV-hsyn-Cre; Fig. 3A). The expression of AT1a mRNA in the PVN was nearly eradicated (Figs. 3B and 3C), affirming the targeted deletion of the AT1a gene specifically in the PVN. The elimination of AT1a in PVN within the FA-CKD model resulted in a reduction in kidney SNS activity (Figs. 3D and 3E), and mitigated kidney fibrosis (Figs. 3F and 3G). Kidney denervation is produced through the blockade of sympathetic outflow. Kidney denervation was given at the same time after PVN AT1a deficiency in FA-CKD model, renal fibrosis was not further improved. Thus, the enhanced, localized Ang II in the PVN triggers fibrosis in the FA-CKD model via SNS activation (Figs. 4B–4D). Consequently, the increased Ang II localized in the PVN after folic acid-induced kidney injury activates the renal SNS, leading to the kidney fibrosis.

AT1aR signaling in the PVN triggers the activation of the PVN-RVLM pathway, leading to an increased SNS discharge to the kidney in FA-CKD model.

We further investigated the mechanism by which activated AT1aR signaling in PVN leads to an increased kidney SNS activity (Fig. 5A). PVN contains excitatory neurons that project to the RVLM, a region involved in regulating SNS outflow. To explore this pathway, we labeled PVN neurons projecting to the RVLM by injecting the RVLM with a CTB-555 (Fig. 5B). In the FA-CKD model, we observed an increase in the signaling from PVN to RVLM, and at the same time, the expression of tyrosine hydroxylase (TH) in the pre-sympathetic neurons of RVLM, which regulate sympathetic nervous system output, was also activated (Figs. 5B–5D). However, by deleting AT1a from PVN, we found that it was possible to reduce the signal transmission from PVN to RVLM and decrease the expression of TH in RVLM (Figs. 5B–5D). This suggests that by blocking the action of AT1a in PVN, it is possible to decrease the PVN-RVLM signal transmission, thereby reducing the central sympathetic activation of the renal sympathetic nerves and exerting a positive impact on the FA-CKD model.