GPR18 undergoes a high degree of constitutive trafficking but is unresponsive to N-Arachidonoyl Glycine

Drugs and chemicals

AEA, O-1602 and AbnCBD were purchased from Cayman Chemical Company (Ann Arbor, MI, USA). NAGly was bought from both Cayman and Enzo Biosciences (in order to exclude the possibility that lack of responses were related to a specific company’s synthesis/production; results were equivalent for both suppliers). Forskolin, CP55, 940, SR141716A, AM251 and AM630 were purchased from Tocris Bioscience (Bristol, UK). Phorbol-12-myristate-13 acetate (PMA) was purchased from Sigma Aldrich (St Louis, MO, USA). U0126 was purchased from Cell Signaling Technology (Danvers, MA, USA). All cannabinoid and lipid ligands were diluted in ethanol prior to storage in single use aliquots at −80 °C. The lipophilic properties of cannabinoids and lipid ligands such as NAGly cause them to adsorb onto the hydrophobic surfaces of plasticware and interact with serum components. To sustain drug availability in assays, the vessels in which cannabinoids were diluted were silanised (Coatasil, ThermoFisher AJA2293; Waltham MA, USA) and autoclaved prior to use, and assay media or HBSS were supplemented with 1 mg/ml bovine serum albumin (BSA, MP Biomedicals ABRE, Santa Ana, CA, USA).

Cloning, plasmid preparation and sequence verification

A plasmid incorporating the gene for amino-terminally haemagglutinin (HA) tagged hGPR18 (HA-hGPR18) in a pCAG cloning vector variant was kindly gifted by Associate Professor Heather Bradshaw (University of Indiana, Bloomington, IN, USA) and the sequence for the inserted gene was verified (Massey Genome Service, Palmerston North, NZ). In order to facilitate establishing a “Flp-in” cell line stably expressing HA-hGPR18, the gene was re-ligated into pcDNA™ 5/FRT (Life Technologies Corporation, Carlsbad, CA, USA) utilising standard DNA cloning methods, and was sequence verified.

In order to generate the putative constitutively inactive form of hGPR18 (A108N, 108 refers to amino acid residue 108 in the hGPR18 sequence Qin et al., 2011); a three base mutation (GCT to AAC) in the HA-hGPR18 gene (in pcDNA™ 5/FRT) was generated using the QuikChange^® (Stratagene) strategy for site-directed mutagenesis but utilising KAPA HiFi HotStart DNA polymerase (KAPA Biosystems, Wilmington, MA, USA).

With the aim of enhancing GPR18 expression and detection, a 3HA amino terminal-tagged version of hGPR18 in pcDNA™ 5/FRT was created, incorporating a 5′ bovine pre-prolactin signal sequence (pplss). This 30 amino-acid sequence is recognised by the signal recognition particle and thereby increases nascent protein translocation across the endoplasmic reticulum (ER) membrane for considerably increased secretion efficiency (Kurzchalia et al., 1986), but (like typical signal peptides) is cleaved prior to surface expression (Belin et al., 1996). The pplss-3HA-hGPR18 construct was generated using the original HA-hGPR18 construct, with the pplss-3HA fragment added at the 5′ end of the coding region (replacing the original HA sequence) using standard DNA cloning methods. The purpose of increasing the number of HA-tags from one to three was to increase the intensity of staining for improved sensitivity of assays utilising immunocytochemistry readouts.

All work employing genetically modified organisms was performed in compliance with the University of Auckland Biological Safety Committee (under the New Zealand Environmental Protection Authority) approval number B00343-GMO08-UA003 (s67a).

Cell culture

HEK-FT cells were received from Associate Professor K Pfleger (University of Western Australia), HEC-1a cells were received from Professor L Chamley (University of Auckland), CHO-K1 cells were from American Type Culture Collection (ATCC CRL-9618, Manassas VA), and human primary glioblastoma multiforme (GBM) cells (NZB11 and NZB19) were received from the Auckland Cancer Society Research Centre (used with the permission of Distinguished Professor B Baguley, University of Auckland, and in compliance with ethical approval ALK/2000/AM03). HEK Flp-In™ -293 cells were from Life Technologies Corporation (R750-07). Cells were routinely cultured in polystyrene vented-cap flasks in a humidified atmosphere of 5% CO₂ in air; except the GBM lines which were cultured in 5% CO₂ under normoxic conditions (5% oxygen; O₂ displaced with N₂ gas). All cell culture reagents were from Life Technologies unless noted. All HEK cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Life Technologies 11995-073) supplemented with 10% v/v foetal bovine serum (FBS, Sigma Aldrich 12203C; St. Louis, MO, USA), CHO-K1 and HEC-1a cells were cultured in DMEM/F12 medium (Life Technologies 11330-057) supplemented with 10% v/v FBS, and the GBM cell lines were cultured in αMEM (Life Technologies 12561-056) supplemented with 10% v/v FBS. Stably-transfected cells were maintained with selection antibiotics: HEK Flp-in wild-type (WT) 100 µg/ml Zeocin™ (Life Technologies R250-01); HA-hGPR18 and HA-TCS-hCB1 (‘TCS’ refers to a thrombin cleavage site between the HA tag and receptor N-terminus which was inconsequential to these experiments) in HEK Flp-in 100 µg/ml Hygromycin B (Life Technologies 10687-010); HEK-FT 400 µg/ml G418 (Life Technologies 11811-031); 3HA-hCB1 HEK 250 µg/mL Zeocin™ (Cawston et al., 2013).

Generation of stable cell lines and transfection

Transfections for stable expression in HEK Flp-in cells were performed using the Flp-in System™ into HEK Flp-in WT cells, according to an optimised version of the manufacturer’s instructions. In brief, low passage HEK Flp-in WT cells were seeded in a 24 well plate at a density of 350,000 cells per well and were cultured in normal growth medium (DMEM + 10% FBS) for 24–36 h until 80–90% confluent. A transfection mixture was prepared, comprising 0.4 µg per well each of the plasmid-of-interest (in pcDNA™ 5/FRT) and pOG44, and Lipofectamine 2000, in Opti-MEM^®. Transfection and selection were performed according to the manufacturer’s instructions, using a selection concentration of Hygromycin B of 100 µg/ml. Cells were perpetually cultured in Hygromycin B to ensure persistent transgene expression.

Initial characterisation by immunocytochemistry indicated that HEK Flp-in cells stably expressing HA-hGPR18 expressed the receptor non-homogeneously and at low levels. Therefore, the population was sorted by Fluorescence Activated Cell Sorting (FACS) in an attempt to enrich for a population of cells expressing receptor more uniformly. Cells in culture were detached from the flask with Versene, resuspended and triturated thoroughly in normal growth medium, and transferred to a 15 ml tube. Cells were counted and treated with primary mouse anti-HA antibody (diluted 1:500; Covance MMS-101P; Princeton, NJ, USA) for 30 min at 37 °C, agitating the tube regularly. Cells were washed twice in normal growth medium, and then labelled with secondary goat anti-mouse-Alexa-488 antibody (diluted 1:300; Life Technologies A11029). After washing, cells were resuspended in serum-free phenol red-free DMEM and 200 U/ml penicillin/streptomycin at a final cell concentration of ∼1.5e⁶ cells/ml. To ensure that cells were in single-cell suspension, this mixture was passed through a 70 µm cell strainer and immediately taken to the flow cytometer (FACSVantage Cell Sorter; Becton Dickinson, Franklin Lakes, NJ, USA) for sorting. The cells with the highest 10% of fluorescent labelling were sorted into a collection vessel containing normal growth medium (DMEM + 10% FBS) and 200 U/ml penicillin/streptomycin, and were thereafter propagated for subsequent use in experiments.

Assay for cAMP with CAMYEL

Generation of cAMP was detected using a Bioluminescence Resonance Energy Transfer (BRET) assay as previously described (Cawston et al., 2013), but using an in-well transfection method. Briefly, on day one, cells were seeded in a Poly-D-Lysine (PDL, Sigma Aldrich)-treated 96-well white plate (CulturPlate-96, PerkinElmer 6005688; PerkinElmer, Watham, MA, USA) in addition to a parallel PDL-treated 96-well transparent cell culture plate. Cells were seeded to be 60–80% confluent following 18–24 h in culture. Cells were then transiently transfected. HEK-FT and CHO-K1 cells were co-transfected with two plasmids; one encoding receptor and the other encoding the CAMYEL biosensor (ATCC MBA-277). HEK cells stably expressing receptor were transiently transfected with the plasmid encoding CAMYEL only. When co-transfection was performed, the total amount of DNA per well was not altered (0.8 µg) but DNA ratios were changed so that receptor DNA was twice as abundant as biosensor (to increase likelihood of reporter/CAMYEL-expressing cells expressing the protein of interest). Approximately six hours after transfection, medium was changed and cells were cultured for a further two days, to ensure maximum expression of the transiently expressed proteins. On day four, cells were washed with 70 µl per well Hank’s Balanced Salt Solution (HBSS, Life Technologies 14025-134) pre-warmed to 37 °C, and then serum-starved for 30 min in 70 µl per well HBSS+1mg/ml BSA (37 °C). Cells were then treated with 5 µM Coelenterazine-H for 6 min prior to addition of drugs/vehicle (in HBSS+1 mg/ml BSA). Immediately following drug addition, emission signals were detected with λ 460/30 nm and λ 535/30 nm bandpass filters using a VICTOR™ X Light Luminescence Plate Reader at 37 °C, as previously described (Cawston et al., 2013). Up to 20 wells per set were read repeatedly over an elapsed time of 20–25 min.

Data are presented as inverse BRET ratios (λ 460 nm emissions/λ 535 nm emissions) such that an increase in cAMP corresponds to an increased ratio. Data from across the time course were analysed by Area-under-the-curve in GraphPad Prism 6 (GraphPad Software Inc., La Jolla, CA, USA). This analysis used the trapezoid rule to compute total cAMP responses for each experimental condition over the time course of that specific CAMYEL run. Data were normalised to a matched forskolin (FSK) condition (100%) and vehicle condition (0%), enabling combination of data from independent experiments.

Quantitative assays for pERK stimulation

Activation of ERK (pERK) was detected quantitatively using an immunocytochemistry method. Briefly, cells were seeded in PDL-treated 96-well cell culture plates (Nunc, ThermoFisher Scientific NUN167008, Waltham, MA, USA). HEK and GBM cells were seeded as described above. For assays on transiently-expressing HEK Flp-in WT cells, transfections were performed 18 h after seeding. Medium was changed 6 h after transfection. Approximately 24 h after seeding (or, for the transiently transfected HEK cells, 24 h after medium change), cells were serum starved for at least 18 h in 60 µl per well serum-free medium (DMEM + 1mg/ml BSA for HEKs, or αMEM + 5 mg/ml BSA for GBMs). Drug/vehicle dilutions were made at 2×the desired concentration in serum-free medium and applied in a staggered fashion with the 96-well plates positioned on the surface of a waterbath at 37 °C. At the conclusion of the time course, plates were immediately moved to an ice bed where contents of all wells were aspirated and 4% paraformaldehyde (PFA) was dispensed rapidly to each well. Plate contents were fixed for 10 min, washed twice with phosphate buffered saline (PBS), and then treated with ice-cold 90% methanol for 10 min to unmask the pERK epitope. Methanol was aspirated and plates air-dried for approximately 15 min before being re-hydrated with PBS containing 0.2% Triton X-100 (PBS+ T). Wells were probed with primary rabbit anti-pERK antibody (Cell Signaling Technology 4370; Danvers, MA, USA; diluted 1:200 in immunobuffer comprised of PBS+ T, 1% normal goat serum and 0.4 mg/ml merthiolate) for 3 h at room temperature, or overnight at 4 °C on a rocker. Secondary goat anti-rabbit (Alexa 594 or Alexa 488, Life Technologies) antibody (diluted 1:400 in immunobuffer) was applied to each well for 3 h at room temperature, or overnight at 4 °C, in the dark. Cells that had been transiently transfected during this protocol were also probed for receptor (mouse anti-HA antibody) to confirm receptor expression (see below Image acquisition and analysis for transient pERK). Nuclei were stained with Hoechst 33258 (Life Technologies H1398) and plates washed. Image acquisition and analysis was performed as described below to determine fluorescence intensity per cell, where brighter staining was indicative of greater pERK. For each cell type assayed, time course data were normalised to pERK levels induced by the presence of 10 µM of U0126 (0%) and 100 nM PMA (100%) and area-under-the-curve analysis (summary data) was normalised for fold-over basal pERK. Data were plotted using GraphPad Prism 6.

Assays for receptor constitutive trafficking and expression

Prior to manipulation cells were equilibrated in serum-free medium (SFM) for 30 min at 37 °C. Unless noted antibody incubations and drug stimulations were performed at 37 °C. When cells required manipulation outside the incubator during an assay (for addition of a drug or antibody) plates were placed on a polystyrene surface to reduce temperature changes by heat conduction. At the conclusion of experiments receptor trafficking was rapidly arrested by chilling assay plates on ice. Following any further requisite antibody incubation, cells were fixed in 4% PFA (10 min at room temperature) and washed twice with PBS.

In order to observe constitutive turnover of surface receptor expression a ‘live antibody feeding’ approach was utilised (Grimsey et al., 2008). This method entailed incubating cells with mouse anti-HA primary antibody (diluted 1:500 in SFM) for 2 h. After chilling assay plates on ice, detection of only surface-resident receptors was achieved by staining with secondary antibody (goat anti-mouse (Alexa 594/Alexa 488), 1:300 in SFM) for 30 min prior to washing with SFM and fixation. As antibodies do not permeate live cells, only receptors resident at the cell surface were labelled. Following fixation with 4% PFA (10 min) and washing with PBS, ‘cycled’ receptors (receptors that had been on the surface at some point during the live primary antibody feeding period but internalised during this time) were detected by applying a different dye-conjugated secondary antibody (549, if 488 was used to label surface receptor), in the presence of detergent to permeabilise cell membranes (1:400 in immunobuffer).

For experiments designed to measure basal or ligand-perturbed surface receptor expression, mouse anti-HA primary antibody was applied for 45 min at 4 °C (in order to prevent receptor trafficking) after drug treatments. Unbound anti-HA antibody was then washed off, and secondary goat anti-mouse antibody was applied to the live cells (in SFM, for 30 min at 4 °C) prior to washing with SFM and fixation.

In order to measure total receptor expressed by the cell, irrespective of sub-cellular localisation, mouse anti-HA primary antibody was applied after the cells had been fixed and permeabilised. After unbound primary probe was washed off, secondary goat anti-mouse antibody was applied for 3 h at room temperature, or overnight at 4 °C.

Subsequent to antibody labelling, cells were Hoechst stained as above and then microscope images acquired and analysed as described below. In transient expression assays utilising single HA-tagged GPR18, staining was compared to a single HA-tagged hCB1 construct: HA-TCS-hCB1 in pcDNA5™ /FRT (also used to generate a stable Flp-in HEK cell line, as described above).

Image acquisition and analysis

For assays involving quantitative immunocytochemistry (pERK, trafficking, expression), readout was from widefield fluorescence microscopy images acquired by automated microscopy (either Discovery-1™ or ImageXpress^® Micro XLS, both Molecular Devices, Sunnyvale, CA, USA; the latter system was utilised for assays on pplss-3HA-hGPR18 HEK Flp-in cells and GBM cells), and associated analysis platforms MetaMorph^®/MetaXpress^® (v6.2r6 or v5.3.05 respectively; Molecular Devices). Acquisition parameters and analysis methods were similar to those described previously (Grimsey et al., 2008). In brief, four images were taken from adjacent sites in the centre of each culture plate well using a 10×objective lens and excitation and emission filters appropriate for the fluorophores of interest, selecting exposure times for maximal detection sensitivity while avoiding image/camera saturation. High resolution images shown in the Results were acquired on the same systems, but were acquired utilising a 40×objective.

For intensity analysis, prior to quantitation two processing steps were performed to automate exclusion of image areas which were not of interest or could negatively influence the analysis (not containing intact cells, or containing artefactual bright debris; these steps represent methodological improvements since our 2008 report). Firstly, Hoechst nuclear stain images were thresholded (applied equally across all conditions under comparison) to identify image areas containing nuclei and a binary mask generated. A ‘dilation’ algorithm was applied to expand this mask area in order to encapsulate the entire cell area (“nuclei mask”). Secondly, images of the fluorophore intended for intensity quantitation (i.e., Alexa 488 or 594) were inspected for any evidence of aberrant bright debris (for example as may arise from secondary antibody precipitation). If present, images were thresholded (applied equally across all conditions for comparison) to encapsulate this bright staining without including any genuine/“real” staining. A binary mask was generated and dilated to expand the mask area in order to enclose the area of “blur” which emanates from brightly stained objects but again does not represent genuine staining of interest (“debris mask”). For all fluorophores/wavelengths, only image areas within the nuclei mask but outside the debris mask were quantitated. Images were also assessed qualitatively; those containing low to medium-intensity artefacts not excluded by automated debris exclusion, or those that were out of focus, were excluded from quantitative analysis. Images were then analysed as in Grimsey et al. (2008) for total (integrated) fluorescence intensity per cell by utilising a user-defined threshold (applied equally across all conditions for comparison), measuring the sum of all pixel grey levels within this threshold, subtracting background (threshold multiplied by pixels within the thresholded area) and dividing by the cell count in the image. Cell counts were assessed utilising the MetaMorph^®/MetaXpress^® dropin “Find Spots.”

For pERK experiments with transient receptor expression, analysis of pERK was separated into cells expressing or not expressing receptor. This was achieved by applying a threshold to the receptor staining image in order to delineate areas with receptor-positive cells versus receptor-negative cells; corresponding image masks were applied to the nuclei and pERK images and analysed for intensity per cell as described above. These custom MetaMorph^®/MetaXpress^® journals are available on request. To quantitate the proportion of cells positive for one or more fluorophores/proteins of interest the MetaMorph^®/MetaXpress^® module “Cell Scoring” or “Multi-wavelength Cell Scoring” was utilised, in accordance with manufacturer recommendations.

RNA isolation, cDNA synthesis and Reverse-Transcription PCR

Pellets of 500,000 low passage cells were frozen at −80 °C. Subsequent extraction of mRNA was performed using the Quick-RNA™ miniprep kit (Zymo Research Corporation, Irvine, CA, USA) according to manufacturer instructions, and then quantified using a NanoDrop™ 1000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). Synthesis of cDNA was performed using the qScript Flex cDNA Synthesis kit (Quanta BioSciences, Gaithersburg, MD, USA) primed with a 50:50 mix of oligo d(T) and random primers, according to manufacturer instructions. Reverse-transcription PCR (RT-PCR) was performed according to traditional methods, using primer-optimised annealing temperatures. Primers used were: human β-actin (forward GCTCGTCGTCGACAACGGCTC, reverse CAAACATGATCTGGGTCATCTTCTC, amplicon of 353bp); human CB1 (forward CAGCAGACCAGGTGAACATT, reverse GGTCCACATCAGGCAAAACG, amplicon of 512bp); human CB2 (forward GACCTTCACAGCCTCTGT, reverse TCCCATCAGCCTCTGTCT, amplicon of 689bp); human GPR18 (forward CCACCAAGAAGAGAACCAC, reverse GAAGGGCATAAAGCAGACG, amplicon of 596bp); and human GPR55 (forward AGTTTGCAGTCCACATCC, reverse GCGCTCCAGGTATCATC, amplicon of 469bp). PCR products were run alongside a 1Kb+ ladder (Life Technologies Corporation, Carlsbad CA) on a gel of 1% agarose (TAE), and stained with RedSafe™ Nucleic Acid Stain (iNtRON Biotechnology, Korea). Gel imaging was performed on a ChemiDoc reader (Bio-Rad Laboratories, Hercules CA).

Data analysis

All datasets were tested for compliance with parametric test assumptions of normality and equality of variance. 1-way repeated measures ANOVA tests were performed on the means from at least 3 independent experiments (Lew, 2007) or as noted. Where statistically significant differences were found over the entire group being tested (p < 0.05), Holm-Šídák post-hoc testing was performed. If the population failed either the normality or equality of variance tests, data were transformed so as to meet parametric test assumptions. If tests for normality or equality of variance still failed, non-parametric repeated measures ANOVA on ranks tests were performed, with Dunn’s post-test if an overall statistically significant difference was found. Post-hoc significance (p < 0.05) is graphically illustrated by the * symbol. Brackets indicate the groups found to be significantly different from a matched control (the left-most bar under the bracket). Statistical analysis was performed using SigmaPlot™ 11.0 or 12.5 (Systat Software Inc., San Jose, CA, USA).

Generation of cell lines stably expressing hGPR18

Expressing HA-hGPR18 in HEK cells using the Flp-in system was expected to result in the gene of interest being isogenically incorporated into cells, thereby producing a cell line where expressing cells exhibit matched expression. However, immunocytochemistry revealed a wide range of expression levels, with many antibiotic-resistant cells expressing negligible receptor below detection limits (data not shown). No antibody labelling was detected in untransfected cells (data not shown), confirming the specificity of the anti-HA antibody. In order to enrich for a more homogeneously-expressing cell population with detectable cell surface receptor expression, FACS was employed to collect the 10% highest expressing cells. This resulted in a population of cells expressing low levels of surface receptor, but moderate levels of total expression which was uniformly punctate and predominantly intracellularly-localised (see Figs. 1A and 1B). By comparison, total expression of HA-TCS-hCB1 in stably transfected Flp-in HEK cells was overall higher (Fig. 1D), with high levels of surface receptor also (Fig. 1E).

Low ratios of surface to intracellular receptor expression can be an indication of high levels of constitutive trafficking (Miserey-Lenkei et al., 2002; Uwada et al., 2014). To test whether this distribution of hGPR18 in the Flp-in HEK cell line was related to the degree of constitutive trafficking, living cells were incubated with primary anti-HA antibody for two hours, and then probed for surface and ‘cycled’ receptor sub-populations (which had traversed the cell surface at some point during antibody feeding, but may be intracellular at detection) by applying different colours of secondary antibody under non-permeabilising (green), then permeabilising (red) conditions, respectively. As shown in Fig. 1C, this revealed considerable intracellular cycling ‘across’ the cell surface, suggesting that GPR18 receptors are delivered to the cell surface but are not retained as a stable surface-resident population. As the hCB1 receptor has been shown to exhibit a substantial level of constitutive trafficking behaviour (Grimsey et al., 2010; Leterrier et al., 2004; McDonald et al., 2007), HA-TCS-hCB1 Flp-in HEK cells were included as a positive control over a matched period of live-feeding anti-HA antibody. As shown by Fig. 1F, the amount of receptor constitutively internalised during the live feeding period was considerably lesser than was observed for hGPR18—labelling in red is predominantly colocalised with surface receptor. This suggests that GPR18 trafficked through the cell surface at a faster rate than CB1R.

In order to generate cells with greater GPR18 expression, transient transfection was utilised. HA-hGPR18 pCAG was transiently transfected into CHO-K1 cells, and transient expression of two different HA-hGPR18 expression plasmids (pcDNA5™ /FRT and pCAG) were compared in HEK Flp-in WT cells. Labelling of HA-hGPR18 expression by immunocytochemistry was compared to single HA-tagged hCB1R (HA-TCS-hCB1 in pcDNA5™ /FRT).

Total receptor expression was found to differ between plasmids. Notably, HEK Flp-in WT cells transiently expressing HA-hGPR18 in the pCAG vector expressed considerably higher total amounts of receptor than both the pcDNA™ 5/FRT for HA-hGPR18, and the HA-TCS-hCB1 (pcDNA™ 5/FRT) constructs (Fig. 2A). Surface expression of the HA-hGPR18 pcDNA™ 5/FRT construct was substantially lower than the level of HA-TCS-hCB1 pcDNA™ 5/FRT expression, although the total expression level of receptor was approximately the same (Fig. 2B). CHO-K1 cells transfected with HA-hGPR18 pCAG exhibited an equivalent subcompartment expression profile to HEK Flp-in cells. Additionally, consistent with the qualitative assessment of trafficking in stably-expressing cells, GPR18 was found to undergo substantially greater constitutive surface delivery and internalisation than cells transiently expressing HA-TCS-hCB1 (Fig. 2C), and this high rate of constitutive trafficking was seen independent of the vector-associated differences in total and surface receptor expression.

These findings were verified qualitatively by widefield fluorescence microscopy which supported our observation of substantially greater ‘cycled’ intracellular hGPR18 (indicating constitutively internalised receptor) than HA-TCS-hCB1 in HEK Flp-in WT cells (Figs. 3A–3C). Images also allowed verification of the constitutive trafficking phenotype of GPR18 in CHO-K1 cells (Fig. 3D), suggesting this is not a phenomenon limited to HEK cells.

cAMP assays by CAMYEL

The CAMYEL biosensor was transfected into cells, and a panel of putative GPR18 ligands was applied at high concentrations (10 µM) to detect maximum possible efficacy for inducing changes to cAMP levels (Fig. 4). Drugs included in the ligand screen were the putative GPR18 agonists NAGly, AEA and O-1602 which were all tested in the presence and absence of 10 µM forskolin (FSK); and the putative GPR18 inverse agonist AM251, which was tested in the presence and absence of 1 µM FSK to make an increase in cAMP more readily detectable. As AEA and AM251 are ligands for CB1R at the concentrations used, cAMP experiments were performed for HEK cells stably expressing 3HA-hCB1 as a control for the methodology and integrity of those ligands. In addition to the FACS sorted HA-hGPR18 Flp-in HEK stable cell line, two transient lines were also tested due to their higher cell surface expression: the HEK-FT cell line was used due to its characteristically high transfection efficiency (important as CAMYEL cAMP signalling detection is dependent on co-transfection of the biosensor and the receptor); and CHO-K1 cells were also included because GPR18 has been reported as eliciting cAMP signalling responses in this cell line (Kohno et al., 2006).

The 3HA-hCB1 HEK cell line elicited the expected Gi-linked cAMP signalling phenotype on stimulation with CB1R agonists AEA and CP55,940 (Fig. 4A). The inverse agonist AM251 resulted in an increase in cAMP levels above those produced by FSK alone in 3HA-hCB1, in keeping with a reduction in constitutive Gi-linked signalling of these receptors. In stable HA-hGPR18 Flp-in HEK cells, the only significant ligand-mediated effects were modest increases in cAMP induced by of AM251 and O-1602 (Fig. 4B). This AM251 effect was also observed in the transiently-expressing HEK-FT cells (Fig. 4C). To determine if this was GPR18 mediated, AM251 was tested in HEK Flp-in WT cells not transfected with receptor and was also found to increase cAMP to approximately the same extent, thus this effect was not specific to GPR18. Finally, no significant ligand-mediated changes to cAMP were detected in CHO-K1 cells transiently transfected with hGPR18.

Phospho-ERK assays

Similar to the cAMP screening approach described above, assays for pERK were designed to elicit Emax responses measured over a time course, for a panel of putative GPR18 ligands. For methodological validation and to confirm (where possible) the integrity of ligands, a HEK cell line stably expressing 3HA-hCB1R was also screened for ligand-mediated pERK stimulation.

As expected, stimulation of the 3HA-hCB1R with 10 µM AEA elicited a robust, highly transient pERK response that peaked at approximately 4 min (Fig. 5A). When analysed by area-under-the-curve, the magnitude of this pERK stimulation peak was significantly different from vehicle (Fig. 5B). In contrast, the panel of putative GPR18 ligands (10 µM) failed to alter the basal level of pERK at any point in stimulation time courses on the HA-hGPR18 Flp-in HEK cell line (Figs. 5C–5D) or HEK Flp-in cells transiently transfected with HA-hGPR18 in pCAG (Figs. 5E–5F). This line was selected instead of the HEK-FT line because of its lower basal level of pERK and more distributed (as opposed to clustered) cell growth pattern, which simplified interpretation and analysis of high-content immunocytochemistry data. High content analysis of pERK immunocytochemistry enabled quantitative analysis of transfected or untransfected cells within the same field of view. No putative GPR18 ligand induced a detectable pERK response either in cells expressing (Figs. 5E–5F) or not expressing receptor (Figs. 5G–5H). A low magnitude vehicle response was seen at the 3 min time point, but this was also present in the sub-population of cells that did not express receptor, and was therefore not receptor-mediated.

pplss-3HA-hGPR18 Flp-in HEK cells

As no detectable ligand mediated responses could be identified by any of the assays utilised in either stably or transiently transfected cell lines, we made a final attempt to produce a cell line with substantially higher cell surface expression by generating a GPR18 construct N-terminally tagged with a preprolactin signal sequence and three HA-tags (pplss-3HA-hGPR18 in pcDNA™5/FRT), which was then stably expressed in HEK Flp-in cells. Again, the Flp-in system failed to generate a cell line with homogeneous receptor expression, with some Hygromycin B-resistant cells expressing very high surface receptor levels, but others below the limit of detection. Nonetheless, in cells expressing detectable GPR18, surface expression was found to be equivalent to the 3HA-hCB1 HEK line (a line known to have adequate surface receptor expression to elicit robust signalling responses; Fig. 6A). Assessment of total receptor expression revealed that the ratio of intracellular to surface-expressed receptor was similar to the first Flp-in HEK cell line used in this study (HA-hGPR18 Flp-in HEK), although the pplss-3HA-hGPR18 cells expressed vastly greater amounts of receptor per cell.

This cell line was then used to detect pERK following stimulation with a range of putative GPR18 ligands. No statistically significant differences in pERK levels were found between ligand conditions, nor between cells that co-stained for GPR18 and cells that did not co-stain for receptor (Figs. 6B and 6C).

As ligand-mediated responses had not been detected in any assays thus far, we queried whether valid pathways were being studied. A common functional consequence of GPCR binding and activation by a cognate agonist is that it responds by undergoing desensitisation followed by rapid internalisation. Trafficking assays were therefore performed on the pplss-3HA-hGPR18 Flp-in HEK cell line. None of the ligands tested elicited significant alterations to hGPR18 surface expression in pplss-3HA-hGPR18 Flp-in HEK cells with 15 min (Fig. 7A), 1 h (7C), or 18 h (7E) of stimulation. 3HA-hCB1 receptors internalised and were degraded in response to AEA treatment as expected (Figs. 7B, 7D, 7F and 7H).

A constitutive trafficking phenotype of GPR18 was described above, utilising a primary antibody live-feeding approach to show that GPR18 undergoes considerably greater surface membrane turnover than CB1R. A previous GPR18 study utilising histidine auxotrophic yeast also postulated that the receptor is constitutively active (Qin et al., 2011), and that this activity could be diminished by a substitution mutation of residue 108 (A108N) of the hGPR18 gene. We expressed HA-hGPR18 A108N transiently in HEK Flp-in WT cells in parallel with the standard HA-hGPR18 pcDNA™5/FRT plasmid. After normalising to total expression, the GPR18 A108N mutant receptor had a higher proportion of stable surface expression than WT hGPR18 (Fig. 8A). In case this putatively less constitutively active GPR18 mutant receptor responded to agonist, pERK assays were performed. However, 10 µM NAGly produced no alteration in pERK activation, although a control condition (transiently expressed HA-TCS-hCB1 in HEK Flp-in WT, stimulated with 1 µM CP55,940) once again validated assay performance (Fig. 8B).

Endogenous expressers of GPR18

The disappointing inability to reproduce published studies on HEK cells expressing hGPR18 led us to search for cells that endogenously express GPR18, based on the hypothesis that endogenous expressers should express the appropriate cellular machinery for mediation of receptor function. Previous reports have suggested that the mouse microglial BV-2 cell line, and human endometrial cell line HEC-1b both express functional GPR18 (McHugh et al., 2012a; McHugh et al., 2014; McHugh et al., 2012b). We therefore screened BV-2 cells (Gibbons, Sato & Dragunow, 2003) and HEC-1a cells (the HEC-1b parental line) by reverse-transcription PCR. However, neither of these cell lines expressed detectable GPR18 mRNA (data not shown). Reports of glial expression (McHugh et al., 2010) of GPR18 led us to screen local provenance primary human GBM cell lines, developed by the Auckland Cancer Society Research Centre. NZB11 and NZB19 are cell lines from the NZB bank of brain cancer cell lines, and are typed as being of right-parietal and right temporal origin respectively. Both lines were found by RT-PCR to express hCB1 and hGPR18 mRNA, but not hCB2 or hGPR55 mRNA (Fig. 9A). In both lines, pERK was stimulated on treatment with 100 nM CP55,940 in a manner sensitive to 1 µM SR141716A (emphasising the specificity of this response to CB1R), but no response was detected on treatment with 10 µM NAGly in either cell line (Figs. 9B and 9C).